EST 1797139 is a singleton


Sequence

>1797139 (1 EST) Length=324 GTGCGTTGTGTGATGTGCTCCAATTGCAATAATAATTATTAAAAAAAAAACCGAGAGCTCAACCCTAAGCGGTGAGAAAT GTATTCAGGGCGGTACAGTGCAGGGAGGGGATGGCTGCTTTTATGTTGTTGTTGTTGTTGTTGTTGTTTTACTACAGTCG CGGCACGTCACTTTCATCGTTCCTTCATCTCCCCGTACACATCCATGCATAAATACACACACACAATAGTTTGCGTGTGT GTACATAATTATCATTCTCCTTGGGCCGCTGCTGACTGTAAAGAGGTGGGGGAGGCTGGGTGTCTGCGGCGGGTGCGTGT TTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797139: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971393331554AI057688TENU1778T. cruzi epimastigote normalized cDNA Library


Date: 11:2:28 on Tue 21 Nov 117.