EST 1797142 is a singleton


Sequence

>1797142 (1 EST) Length=412 AGCCGCGTGGGGAGTGTCCTTACACTTCTACAGAGCGTTGCGTACGATGATTCTACCCGTAAATTATTTTTGGAAGCCCA TATTTGCCTCTTTCTATATCCATTTCTTCGCGGGACGGGTAGCGGAACGGGGAATGTGACGGAGGGCCTTCGTCTGACTT CACTTGGCGTCATTGGTGCTCTTGTCAAGACGGACGACAACGATGTGATGCAGTATCTTCTTAGCACGGAGATATTCCCT CTGTGCCTTAAAATAATGGAATATGGACTAGAGCTCTCACGGACTCTAGCCACCTTCATTGTGCAGAAACTTTTGCTCTC AGATCTCGGTCTGCAGTATGTCTGTCAGACGCCAGAACGATTTAAGGCCGTCGCGGCGGTTCTGCAGAACATGGTGGGAT CGAAAGAATGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797142: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971423331557AI057691TENU1781T. cruzi epimastigote normalized cDNA Library


Date: 0:31:25 on Fri 24 Nov 117.