EST 1797152 is a singleton


Sequence

>1797152 (1 EST) Length=371 GCGTGGTTGAAAGGGTGATGCTCACAGAAAACAGTGGCAATCGCTTTACCAAGGTGAAGATTCGCACCATTAAGATACCA AACATTGGGGATAAGTTCTGCAGTCGTCATGGACAAAAGGGCACAAATGGTATTCAATTCCGTCAGAAGACATGCCTTTT AACCGTGACGGAATTGTTCCAGATTTGATTATTAACCCACACGCCATTCCCTCACGCATGACTGTGGCGCATCTTATTGA GACACTCGCAGGCAAGGTGGCGTGCTATAAAGGAAGTGAAGTTTACGCCACGCCCTTTTGCTCTGTTGTTGTTGAGGACT TTGGAAAGGCTCTCCATCAACTTAAGTTTCAGCGCTACGGCAATGAGTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797152: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971523331567AI057701TENU1791T. cruzi epimastigote normalized cDNA Library


Date: 17:5:9 on Wed 22 Nov 117.