EST 1797153 is a singleton


Sequence

>1797153 (1 EST) Length=279 ATTTGCTTTGTTGGCAGATGACCCCTTACAATGCATCAAAGTTGGAAAAAGAGTCTTATCGATTTCTCTTACAGGCTGCT GGGTATTTTTCTCTTCTTCAAGAGATGGCTCATGATGTGAAAAGCTATTGCGTTGGCACGACTGAATTGAAACGCTCGGA GGACCTCCAGGAAGAAATTTTGGAATTTTTACGCCTTGTAGCTCTGGCTCAGGCGCAGGAAATTGGGGCGACCAAAGCTG TTGAAAATGAAGTAAGCGGTGGCAAGTCAATGGTGGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797153: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971533331568AI057702TENU1792T. cruzi epimastigote normalized cDNA Library


Date: 12:7:10 on Fri 24 Nov 117.