EST 1797156 is a singleton


Sequence

>1797156 (1 EST) Length=340 ACTGAACAAAGAGGGATTTATTGCTCTCTGTGAGAAGGCCGTGGAGGGGCTCTCCAATCCACATGCAAGTCCACTGGGTC GAGTGCCTCCCCCACGGATTCACGCGATGGAGGCCAATCTCACGGATGATGACAACGGCAGCTATGCAGGGGCACGAAAG AAGTTTCAACGTGGAGCTCTTTCACCGGAGAACTTGAAGAAGTGAGGGCCCGACGAGTGGAACGGAAGCGGCAATTGGCG GAGGAGGAGAATCAGAAACGTCAGGCAATGATAGAGGAAGAAATGCGTCAATGCAGCATTCCGTCCGCCTCCCCCTAGGA AGGTGCCACGAGAGTGTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797156: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971563331571AI057705TENU1795T. cruzi epimastigote normalized cDNA Library


Date: 8:22:47 on Wed 17 Jan 118.