EST 1797161 is a singleton


Sequence

>1797161 (1 EST) Length=277 CGCTGACGGTGGAGGATACCGGTATTGGCATGACGAAGGCGGACTTGTGAACAATCTGGGCACGATCGCGCGGTCCGGCA CAAAGGCCTTCATGGAGGCGCTGGAGGCCGGTGGTGACATGAGCATGATTGGCCAGTTCGGTGTTGGTTTCTACTCGGCG TACCTTGTGGCTGACCGCGTGACGGTTGTGTCGAAGAACAACGACGACGAGGCGTACACGTGGGAATCGTCTGCTGGCGG CACTTTCACCGTGACGCCGACGCCGGACTGTGACCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797161: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971613331576AI057710TENU1800T. cruzi epimastigote normalized cDNA Library


Date: 11:49:55 on Wed 22 Nov 117.