EST 1797162 is a singleton


Sequence

>1797162 (1 EST) Length=215 GTTGAGGGAGGCAGCGGACACCTTGAGAAGGACCAGTACTACGAGCTCGCGATTGGTGCGGTTGCCATCGCTGACAAGTA TCTCCGCGCCATTGGTGACTACAAGGGGGCGGCGCTAGTGCACACGGCGATGGGCACGTGGTGCACGGCCATTGCCCAGC AAAGCAGGCGGCGAAACCATCGCTACTTTNTCCTGTGGGCCCGTATGGAGCGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797162: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971623331577AI057711TENU1801T. cruzi epimastigote normalized cDNA Library


Date: 12:52:47 on Sat 18 Nov 117.