EST 1797164 is a singleton


Sequence

>1797164 (1 EST) Length=331 GGGGATGGTGCGCTGTTCATCGTGCTATGCCTCGGAGGCTAACTGCGGTGAGCGGATCCGCGGCGGGAGTGGCACACGCA GGGTGAACACACAAAAAGACGTCCATGAACGTTTATTTCTCTTGTCGCAACGGAGGAGATGCACGTGTCAGGCGCCTCTC CATGTGGAAGAAGATGACAGTGACGATATCAACTGCACCTTTATGCCTGCTATCAACCACACGCATGAGGCGCTTCTTTT CCGCTGGACGGAGGGCGTAAGTGTATTTGAGCGACTCTATGGCAACGCGCTTTTTCTGCAGCGAAGAAAACAACAGTTGT ATGGGTCGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797164: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971643331579AI057713TENU1803T. cruzi epimastigote normalized cDNA Library


Date: 22:59:56 on Fri 24 Nov 117.