EST 1797169 is a singleton


Sequence

>1797169 (1 EST) Length=266 GTGGTCTTCAGGGGACGTATGTGCTTGTGCCCCTTCCGCAGAGAACACACATTCCTCACTGCACTGGACACACCGTGGCG TCACCACGACACAGACAAACCAACCAGTAAATAAAAACACAAACAAACAAAAAANAAAACACGTGCAGAGCACTTAGGAG GAAACACCCGAGCCGTGCTTCTTTGCCCACGCGTCAAACTTTTCCAAATCCGATCTTTGCACACTACTTTGTGTGCACGC CACACTTGCCATGATGTCCTTAATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1797169: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971693331584AI057718TENU1808T. cruzi epimastigote normalized cDNA Library


Date: 15:2:13 on Wed 22 Nov 117.