EST 1797171 is a singleton


Sequence

>1797171 (1 EST) Length=387 GGCATCTCCTGAAATGGATGAAATAGCGTACAATAAGTTCAGCCTCAACCCTCTTAATTGGTTCATGATGCTGAAGGAAG TGATTGTGTCTGCTTTATTCTCCATTAGTTCCAAGCGTTGTATGTATTCACAGGCGCGGATGACAAACTTGGGTGGAGAA AGGGATCAGGCGGCATGCCAGCGGGAGATTCGACGAGCAGTCCGAATCATAAAGGAACGTCAATCCGTGACGCAAGGAGA CAATGACGTGACTGCGCACTCATCCCCGGGGCGACTACTTCATTTGAAGCTTGTGTTGTTTGGTTGTAGTCGTGGGGCCA CCACCACATTTTACACAGCGATGAAACTACCAATTGAATTGGCACAATATGTTTCTCTTGTAGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797171: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971713331586AI057720TENU1810T. cruzi epimastigote normalized cDNA Library


Date: 2:40:55 on Fri 24 Nov 117.