EST 1797183 is a singleton


Sequence

>1797183 (1 EST) Length=327 TGGGCGCCACCGCAGCGCATCTGTTGTCTGACGGGCGTTGCAATGTTCTTTGCCTCGCGTGGTGGATGCGTTGCACGAGT CGGTGTCGTAGTGAGATGGGTTTATATGACCTGGGCGAAGGGTCGGGCGTTCGCTGCGCTTGTGCAGTAAAAGGTGGCAG CAGTGTCTGTTGTGGCTCTCGGTGCGTTTCTCTAAGGCACCTCAGTGCGCTGCATGCGTCTGAAGGTGCGGTGTCACACA CCAGCCCCACGAGAGTTTGTTCCCAGAGGAGCTTTGAGACCCCCCGCATCGTTTGTCCGTCGGCCACCGCCACGGAACGG AAGGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797183: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971833331598AI057732TENU1822T. cruzi epimastigote normalized cDNA Library


Date: 2:42:59 on Sat 25 Nov 117.