EST 1797184 is a singleton


Sequence

>1797184 (1 EST) Length=297 TGTGGAGAAGGAAGAACCGAAGCTCAACGAGGATGATGAGGTGGAGCGTTGGATGACGAGCATTGCAATGAGCGAAGAAG TAACAAAAAAGGTCACCAAGTCTCGTTTCTTCTCTGGGAATGATTCCGACAATAAGGGTGCGGTACCTCTCCTTTGAGCG GAGGGCAAGCATTTAAAGAGACATCTGCATTTTCAATGACAACAACGAGCAAGGATCCGTGGGCCCTGCAGGGGGTAATA CCCACAACAACTGGAAATGCGGTTTGGGGCAACTTGGAGACACAACGGAACTCGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797184: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971843331599AI057733TENU1823T. cruzi epimastigote normalized cDNA Library


Date: 8:25:57 on Wed 22 Nov 117.