EST 1797187 is a singleton


Sequence

>1797187 (1 EST) Length=362 GTGTACAGCCCATTAGTGACAGGAGAAGGTGGAATTTGTGATCGGATGGTTAGCGACTTCTGGACTCCGGACCAGCATGC CTCAGACGTCATCAAACTTGTATTGGACAGGGTATTTTCTCAATACAAGAGCCGCCGTGATGATGATGTGAATCCTGAGG CGCGTCATTATCTAGAGAAATTTCCGCAGGATTTTGCCGCACGAGTACGACGAGGACGTGGATAACCCATGTGTCATACA CATGATGAACTTCATTGAAGGCCGTTGTTGTTGTTGTTTATCGTATATTTCCAGCTGTCCATCCTGTTGTTAATAGTCGT TCAAAGACACAGTGTGTTTCATTTCAGATGTGTGGGTGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797187: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971873331602AI057736TENU1826T. cruzi epimastigote normalized cDNA Library


Date: 4:31:46 on Mon 20 Nov 117.