EST 1797194 is a singleton


Sequence

>1797194 (1 EST) Length=240 CCGTTTTATATGTGCTGTCAGCTTATTTAACCCCTTTTTTCTTTTAAATTTCCCGTGACGGAAGTTGTTGCGGGTGTACT GTGGAATTTGCCATGTCACTGCCCGCAGCGCCGACACTATGAGGGGAATGGTGGCGTCGCAGAGACATGACCCCGTGGCC GTCGGACGATTTATTTCGGGTCGTCCGTTGCATGGCATGCGTCGTATCGGCTGCGCATTTCATGTATCCCCCTCCCGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797194: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971943331609AI057743TENU1833T. cruzi epimastigote normalized cDNA Library


Date: 4:26:26 on Wed 22 Nov 117.