EST 1797202 is a singleton


Sequence

>1797202 (1 EST) Length=377 CCCCCCGGTGGATGACCGGAGCCAACGACGGTGCGGGCGCGGCTTAACCGCCCTTTTGAACTCCCGACACCATCAACCGC TTTGCCCCCATTGTGTCTTCCACGGCGTTTTACTGCGTTTATGCGTAACTTTGAACGTGAAAAACCCGGAATGCTGAAAA AAAAAGGAAAAAGAAGTAGAAACCGCAAACTTTTGGGAGGTATTTATCGTGTCTCTCACGCGCAAGAAGGAGGGGTCATT TGGGTGTTGCACTTCTCATGGAGACTTTGATTTGTGGATAAATTTTGTCATTTACCTCGGAAACACTCCATCCAGCCTCA CGAACCATTAAAATTACTGGAAAGGGGTAAAAGGGACAGAAGGGAGTCTGCAGAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797202: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972023331617AI057751TENU1841T. cruzi epimastigote normalized cDNA Library


Date: 20:10:36 on Sat 18 Nov 117.