EST 1797203 is a singleton


Sequence

>1797203 (1 EST) Length=323 AGTTCTTTGAGCAGAAATGCACCGTCAGAGGCGTCCTTTGAGGTTTTAAGCCTCGCTGACTCACAAAGTCTTCTGCGGGA GTACGCGTTATCTGGCGATAAAACCCTGCCATTTGATGCGGATGAAAAGGATCTTCAAAAACAGTCGCTTGTGGGTCCAG TGGCCGTGCAGTCCATGACGAGAGAGGATGCCCAGGCGTTGCAGTATAACCGCGGCGCACCACGTCCCCGCCGCACCGTA AGATTCCGATTGCGTCCACCAGTGGATGCTGACATCCGACAGCAGGAGGTTTGGGAACCGCATTGGGCGCGTCCTTGTCA TCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797203: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972033331618AI057752TENU1842T. cruzi epimastigote normalized cDNA Library


Date: 23:51:41 on Fri 17 Nov 117.