EST 1797220 is a singleton


Sequence

>1797220 (1 EST) Length=274 CCGGTTTCAAGTTTTAATAGTGTCTTGGCAACTGGGGCAGATGCATCAGTGGTGGAAGAGGTGCGTCAATACTGGTTAGG AAAACGGCAAGCCTTGGGTGGTAATATACCATGTATTCCATCTCTCCATATTAATGTTCAAGAAGATAATCAGGTGTCTT TGTGTCACAACGATATTCTTCAGCTTTGTCCCCTTCCCTTTAATCATAGAGACTGGTCAATTGCAGTCTTGCAACGCCGT ATTCCAAATGTTTCTGAGGTGAAGCTGGCAGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797220: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972203331635AI057769TENU1860T. cruzi epimastigote normalized cDNA Library


Date: 22:12:6 on Fri 17 Nov 117.