EST 1797221 is a singleton


Sequence

>1797221 (1 EST) Length=219 CATACTCATTCATTTCTGATTCATTCATTTATTCCTCGCCGTCCTGGAACATTTTTTTTTGATTTTTTGTTTGCACAAAG TATAAAAATCCAGCTCGCAGGGAGAGTTTTTTTCTTTTTTTTCTTTTCTTTTGTCTGTTTGTCTGTTTGTCTGTGCTAGC GGAAGAAGAAGGGTTACCCTTGCGTGGCATCGCTCACATTCGCCCTGTCTCTCTCTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797221: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972213331636AI057770TENU1861T. cruzi epimastigote normalized cDNA Library


Date: 9:8:8 on Sat 18 Nov 117.