EST 1797236 is a singleton


Sequence

>1797236 (1 EST) Length=507 CGACTGTGCGGCGCGGTGTGGCGTGCTACATGCTGGTCCTTGCGCTCTTGTGCAGCAGCTGCTGCATGTCCGTCCGCGGG GCTGCTGCTTCGGGCGTGGAAACTACCGCTGCGCTGCAAAAAACATGGACGGATGTGGAGGTGTCGTGTTTGGGGACTGA CGGTAGGTTGAGTTGGCGTCCCTCCGGCGAGAATGATTGGCGAAGGTGTGCGAAGAAGCCCGGAGAATACGAGAGCGTCA CGGATGACTGTGCACGGCTGTGCGATGACGCTGGAGAATTCTACACGTCGAATATCACCGGGCAATGCCTCCTGAGGGTG CTGAGAGGGATTTTGCCTTCACGATGCTATTTGCGACTTACGGGAATATACAAAACTGCACTTCGGCGCCGGCAGAAAAC CGTCCTCAGTTGGGCGCTGGCGATGCGCAACCAGGCCAGTCGCAATCGCAGGCCGGAGCCGCGGCTGCACCGAAAACGGC GGGTGATGGCCTGAAACGGAGCGGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1797236: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972363331651AI057785TENU1876T. cruzi epimastigote normalized cDNA Library


Date: 7:25:33 on Sun 19 Nov 117.