EST 1797241 is a singleton


Sequence

>1797241 (1 EST) Length=309 AAAAAGAAAAAAGAAATAAAAATGAGGGGAAAAATTTTAAGCGAGAAAAAAAAAAGAAAAAAAATTGTCCATGCATGTTG TTGTTAGCGTTTGTTTGTGTGTGTGTTTTGTACGTCTCAGAAAAGGGAGGAAGAGGGAGAGAAAGAGAGCGAGAGGAACG ACGGGATTGTACATATTTTTTCTGTGTGTGAGTGCGTGAGTGGGTGTCAGACTGCGGTGTGAGCCGACGGTACCACACAT AACACGCCTTGCATTGACATGCATAGCTGGCACAACGTGTACGCACATAACTCGACAATTTATTTATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797241: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972413331656AI057790TENU1881T. cruzi epimastigote normalized cDNA Library


Date: 16:36:16 on Tue 16 Jan 118.