EST 1797247 is a singleton


Sequence

>1797247 (1 EST) Length=468 TCCCCAAATACAATACATTGATTTAAGCCTTAAACTCCGTTTTCCCTCCCTTCTTCCGCTTTACAGCGCATGTCCTGCTA CGTGGTGTACCTCATCCACCCGTCAATGATGATGTTTTCCTCCTCCGTAATGTTGTAGGCGTCATGGATGGGGCTGTACA GCATGCGAATTTCGCGGGAGTGGTTGTGGTACGGTCCGGGCCACATCTTGTTGTCCCAGTTCTGCTCTGCAACGAGAACA GAGTTCTTCGTCACACCGACAACGACGGCGACGTGTCCAAACGGAAAATCCTCCCGCTGACGCGGTATATCAGCAGGTCG CCGGCACGCGGAGGAGCCGCCGTCACGGCGTGGGAGGCCGTTGGGGTATTTAAGCAGCGGCGTTTTAGAGCCGTCAAGAG CCGCACGAAGTTCAGTGCCCAAATGTCGGCAGCTCCGACCACTGAGTCAAACGTTGCACGCACGGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797247: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972473331662AI057796TENU1887T. cruzi epimastigote normalized cDNA Library


Date: 6:15:49 on Wed 22 Nov 117.