EST 1797258 is a singleton


Sequence

>1797258 (1 EST) Length=555 AGTTGCTGCGTGTCTGTGGTTGTGCGAGACAGAGTGAGAAAAGGAGTGAGAGATGAACACCCGCTCCAAGAGAGGCAAGC GAAAGGGCGTTGAGGAGGTGGAGGTCCATGAGATTGCGAACACCTCGCCCGATCCCGTTGCAGCCCCCGAACAGCAGCAA CAGCAGCAGGAGGATCAACAAAATGTGGATGGCGCGAACAACGGCGGCTTTCGCGTTATCCAAGTGCTAGAAAGCTACGG TATTGCCTCTGCAGACATTAAAAAGCTCATGGAGTCTGGTTTCTACACCGTCGAGTCAGTCGCGTACACACCCAAAAAAA ACATTTTGGCTGTCAAGGGTATCAGTGAAACGAAGGCGGATAAAATTATGGCGGAATGTGCGAAATTGGTACCAATGGGC TTTACATCCACCACCCGACTGAGTCTTCGCAAGGGACGGGGTGAACAGCGCATCATGAAAGTGTACGACTCACCTTGCCT CGCCGAGGCAGAGGCCATATTTGGCATCTACGAGGATGGCGTTGGGGATGCAAGGGATTGACAGTGTGTAGCGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797258: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972583331673AI057807TENU1898T. cruzi epimastigote normalized cDNA Library


Date: 0:8:1 on Sun 19 Nov 117.