EST 1797259 is a singleton


Sequence

>1797259 (1 EST) Length=423 TACCCATATGAGGCGTGCCTAAACTATATCAAGGGCAAGTGCCGTTTTGGGCAGCACTGCAAGGAGCTGCATGTGACCTC TACGCATTCTCGCTATCCAGGACAGCGCAAAGGCAGCAACAACAATCAACAAGCTAACAGTGGTGCCACGCCTGCCCAGG CGGAGGAAAAGGAAACCAATGTGAAAGAGAAGCGAGCCACGAAGGATAAGGACAGCAGCAAAAATAGCAGCACAAGAGGG GAAACAAACAGCAAGGAAAGCGTTGAGGAACAGCAGGAAGCGAACGCAACTCCAACAATGACACCGAAGTCGGAGACCGA CGCACGGCCGGCGGAACGCCCGTTCTGGTCGAGGAGAAGGCCTCATGAAACACAGCAGGGCGAGACCGAAAGTTGAACGC ACCTACCACTCCTTCATCGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797259: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972593331674AI057808TENU1899T. cruzi epimastigote normalized cDNA Library


Date: 6:5:59 on Wed 22 Nov 117.