EST 1797260 is a singleton


Sequence

>1797260 (1 EST) Length=540 CTGGAGTTCAACTTGCAGGCTGCGTCCCTCTAGAGCAGCTTGTGGGTATCACGGTCAACACTCGCTCGGCGTCATTTCGG CCAAACTTTTTGTCCTTGCACACGATTCGAGGACCACGGGTCGACAATCATCGCCTGAATCTTCCGACTGAAGGCGGATT TTCCCTTTGGTTTATTGACCGTCACCATGGCACCGCAAGGAGTGTGGACCTCCTTACATGTAACTCAACGGTATTAGACG TATGGACAAAGGCTTTTAAGGGCTTAGTGAGTGTGAACAGCTCTTCTCTTGTGCAGGTACCTCTAACAAGTGCGGGTATA TCTACTGAAATGGAGAAGCTGACAAAAGAGGCGCAACAGCAGGTGGAGAAAAGTATTCTTTAGATTGTGTCGCTCCAAAC ACTTTGGAAGGAACAACAACAAGTACAATTTTAACTTTTTATCGCTATATCTACAAAAAATTATGCGGGTCCATCCGTGT AGATGCATCTGCGTGGATACGCATGCCTCCTCAATTTGTGCTTATGAGGAGGTTGGTGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797260: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972603331675AI057809TENU1900T. cruzi epimastigote normalized cDNA Library


Date: 23:3:34 on Wed 22 Nov 117.