EST 1797265 is a singleton


Sequence

>1797265 (1 EST) Length=650 GAGAGTGATAGATCAAGGGCAAGGTGGCGGGTCCACTCCCACAATTGTCAAGGGTACGGAGAATGAAGGAAACGGCTCAC GCCCTCAAAGACCCGTGGTTTCTCAGCTACATTCCCCAGCTTACTCCAGACACCGTGAAGTATGATTTCAAGGGGGACTG GAACAAAGCCAAACAGGCACTCCAGCAGCCACTTGACTACATCCGCACTGTGGAGGAGTTTTGGTCGACCATAAACTCGT TACCAAAGTTGCACCAACTGGGAAACGGTAGCACATTCATTTTTGCTCGCAACAATGTTGATGCAAGCTACGAAGCCTTT CCCAATGGTACACGGGTTCTTGTGGATCTTTACAAGGCGTCAGTTGCAGAGAAGGGGATGGATTTCGTACTGAGCAGCGT TCTAGGGGAAGGACTGACTTATGACGTTTGTAACGGTAAAACGGTGTGTGACGTGGTACGTCTTTCTTCACGTCCCAATC AAGAGTCCCCTGAGTTAGTGCGTCTAGAGGTGTGGCTCAGCGATCAGTTGTACGCCAAAGATGTGATACCTTATATAAGA AGGGGACTCAATGAAGCTGGTTTAAGTTTCACGGATTTTATCATGGGTGAGTCAACTTTTGAAAAGGATAAGAAGAAGCC ATCGGTGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1797265: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972653331680AI057814TENU1905T. cruzi epimastigote normalized cDNA Library


Date: 14:36:15 on Sun 19 Nov 117.