EST 1797266 is a singleton


Sequence

>1797266 (1 EST) Length=505 CGTGTTGATGCTCGCTAAGCGTTTGGTGAATGTGCACTTCAGGTTGGGCCGTGGATCTTTCAAGTCGATTAGAACGGCTG AGAGAGAGATTTTACTGCGAAAACTGAGGTTTCAAGTGAATCCATTGTTGTAGAGAATGAGGCCAATGCGAGTGATGTGG CATCTCATTGTAAACACTTGTTTCTCTCGACTCTGTCTGCCTCCGAGCTGCAGCATGCGCACGATGGGGATCCTATGGAG GATTTTTTTTGTAACGAACTCTGTAATGAAAATAAGGACGGTATGATATGTTAGTTGTTGCCTCTTTATTTTTAATTTCA CGTGTTTGTGTTTTTGTAATTTCCGCGTGTGTTATTTGTTGGTGTTCTTTTGTCTCCGGCACAATTTGCAGAAAAAATGG CCCTCATTTGGCTGCCGTCTTTATTTTTGTTAAAAGAATTTCTTTCGTTGAAAAACTGTGAGTTTTCCCTCGTCTGCGTT CCCGCTCTCACGGAGAAACGAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1797266: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972663331681AI057815TENU1906T. cruzi epimastigote normalized cDNA Library


Date: 15:58:32 on Fri 17 Nov 117.