EST 1797267 is a singleton


Sequence

>1797267 (1 EST) Length=483 CCGTGGGACTGGACCTTCTCGCCTTTGCGTATAGACGACACAATATTGTTCACACGACCTTCCTCACCAACGCCCATACG ACGTACGGAGTCTGCCAGTCGCTGCATCGACGAAAGCTCCTTCTGCGCGCTATCCAACACGCGCTCACGGTTGGTGACAT CCACCACGACGCAGCGTTTCAAAGAGTTCACCACACGATCAACCGTTGGAAATAAACTCAACATTTCGCGGTTAAACTGC TCCACCGATAGTGCCGGTGATCCCCTGACACTGTCCGGACGCATGACGCCTGTATTTTGGCGAATATCCTCCGTTCGCTG CTCCAACTCCGCGCAAACATCCTCGTACTCCTTTAAAAGACGTTTATTTTCAGCGCTCAGCAGCTCGCACTCTGTTTTAT AATTGATGACTCGTCCGGATGCATCCTGGGCGTGAATATTGGCGTCCCCAAGTTTTTCCCGTAACGCCTCCAACTCCTCA TTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797267: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972673331682AI057816TENU1907T. cruzi epimastigote normalized cDNA Library


Date: 3:59:13 on Sun 19 Nov 117.