EST 1797276 is a singleton


Sequence

>1797276 (1 EST) Length=230 TGCGTCCTTTAGAAAACACCGTTCTCCGCTTACTTTTTTACCTTTTTTCTTTTTTTTTTTTATGAGCGCATATTTTGTTT TTGTGTGTAGTTGTGCTCGTTGTTGTTGTCGTCGTTAATTTTTTTTTCCTCCTTTTCTCTTCTGCAATAATTGTCTCGCT TTGGGTCGCCGCTAATGTGCTTCGGCTCAACGGCCAATGTAATTGAGGAAAGCATGGGCCACCTTTGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797276: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972763331691AI057825TENU1916T. cruzi epimastigote normalized cDNA Library


Date: 12:3:16 on Fri 24 Nov 117.