EST 1797277 is a singleton


Sequence

>1797277 (1 EST) Length=471 TGCATATCATCGACCAAATGACATATTTGAGGAATTATTTGGCCGACATGCCGGTATGCATGCCGCGGGGGGACATGTGT ACGAGACCGAGTTTCATCCCAATATTCTGATGGCAGCGCATTGCTGATATTTTTGTTCTTAGCAATTCTTTTGCAGTCTT CTTTAACAGAAATAAGCGAGTATCATGATCCTCGCGCGGGTCGCCGTGATAACGGCAAACACGTTCAGTCTTACACCGGA TCCGTTGCACGGGCACGTGGTGGAGCGTATGACCTCCCAAAATGGGTTACGAGTAAAATACTATGTGCATCGGGCGTGGG CGGATCGAGCGGAACCGGCTACGCGATGTACGCCGCATGGAACGAGAGGTCCTGAAGCAGCAACAAGAATCCTTGGCACG TCGCTGTGAGGCAGAGTCACTATCGTACAGAGCACGTGGAAAGAAAGACACGCCTCCCATCTGTGTGGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797277: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972773331692AI057826TENU1917T. cruzi epimastigote normalized cDNA Library


Date: 18:42:46 on Sat 18 Nov 117.