EST 1797290 is a singleton


Sequence

>1797290 (1 EST) Length=339 CCTGCTCTGTGCCTTTGAAAAGGAAATAAGAGAAGGACTGCAGAGCTACCGCGATATCTTGGGTTTTATCACTTCCAAGA CAGCCTTGACGCTCCCTGTGCTCTCAGCCTCTCTGGTGTACGTTAATGGGATGTTTACCCCGACGCTAAGGTACGGTCAA CTTGTTTCTTTGCAAAGGGATGTATTTGGCCGCCACGGATACGAGCGGCTAGACAAGGAGGGCCGTGAATCCCACCAATG GCCGGAGCTACAGTGAGAATGCTCAGTTTTTTGTTTTGTTTGTTTCTTTGCTTTCCTGGGTAACGTGGCCGACTCAACAA AAGTATATTGTCAATACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797290: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972903331705AI057839TENU1930T. cruzi epimastigote normalized cDNA Library


Date: 14:5:22 on Fri 17 Nov 117.