EST 1797304 is a singleton


Sequence

>1797304 (1 EST) Length=378 CACCACTCCTCTTCCCGGGTGCGGGAGGCAGGCGCTGGTGACAAGAAAAGGAGCACGTGCGTGGGGGATTTTTAGTGACG CATGACGGCGCTTCCCGTGTACATTGCACGGTGTAGGCAATGCGGCAACTCGCGCCGCACATACAACGACCCACGACTCG GGCGCAGTGTGATTGAGTGCAAGGCTGCTTGCAATGAGTCCCACTACGAGTGGGACTTTGTGGAGGAGTGCAAGGCGGAA GAGGCAGAGAACACCGCCAGTAGTGTTCCTCTTCCATCCGAGGCCACGCCGGCAAGTAAGGGGACTGGAGCGTCCAAAAA GCATCGAAGGATGACTAGTCGTTGTACCGTGGTGTGACGGAAAAATTTGGAGGTGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797304: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973043331719AI057853TENU1944T. cruzi epimastigote normalized cDNA Library


Date: 19:21:16 on Thu 23 Nov 117.