EST 1797305 is a singleton


Sequence

>1797305 (1 EST) Length=157 AAAGGGCGATCCCAAAGACAGGCAAACACATAAACTGCCGTTGCATTCCTATCCGACGATCAGCAAGCCGTGTGACTCCC TCCACAACACAAAAGCCACATAATGCTTCATAAATTCACACAAAGAAAAAAAATTAAAATCCCCAACAAAAAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797305: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973053331720AI057854TENU1945T. cruzi epimastigote normalized cDNA Library


Date: 6:46:52 on Sat 25 Nov 117.