EST 1797317 is a singleton


Sequence

>1797317 (1 EST) Length=320 TCCCGCGTGGCGCAGGGACCATCTAACGCTGCGATGCCCGGCACTTCTTTCCCGTGCTGCCTCCATGCACACACCGTCAG TGAGGCGCCGGCCACGCCGTGCAACACAAAACACAAAAACAGACACACACGCAAAGTGCAGCGCACGATTGCCGCGGAGT TTTGTTTTCTCCGTCGCATTCCCTTGTTACGAGGCTGGCAATAATGCACTGGGGGGAAGCTGCATTCGTTTTTAAATTTG TTTTTCACCGTGTTCTTTCGAGTAAATCTGATGGCCTTGCACACCAGTCGCCATCGTAAAGCACGTCCGCTCTCCTGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1797317: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973173331732AI057866TENU1957T. cruzi epimastigote normalized cDNA Library


Date: 22:19:50 on Tue 21 Nov 117.