EST 1797327 is a singleton


Sequence

>1797327 (1 EST) Length=170 TCTTACGCCCAGATGGTGTGACCGGTACCTCTGCGCCATGCGGAATTTACTCGTGGCGTTTTCGGTAAATTCTCGAGAGG CCGAGTTGCTAAACGCGCGCCGAGAGGAACTTGAGAGGATCACGCAGCAGGAGATGATTCATGCGGCCTTTCTCCGCGCC GCGCAGGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797327: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973273331742AI057876TENU1967T. cruzi epimastigote normalized cDNA Library


Date: 20:31:7 on Tue 21 Nov 117.