EST 1797328 is a singleton


Sequence

>1797328 (1 EST) Length=421 TGAGTGGTCTGCTTTTACAGACCTCAATATACCGGAGAGGTGCGGGTAAAATGCATGGGAAAGCCGTCTCTGAGGGCCTT CCATTACTTTGAGAAGTATCCGCAGTACTTTGAGGTACGGCAGCAGGGGATTACAGATCATTCGTTTTACGTGCGTCGCT CTTTGGCGCTACAACGAAAGACGGAAAAGCCACCTTGAAGTTGGTTGTGTGTGTGTGTGTTGCTTTATTGATTCTTTTGC CGCTGCTTCTCATTTCTGTTTCTAGGGAAATCCCAAATGGAGAAAAAAAAGAAAAAAGAAAGGAGAAAAAGAGAGAAAGA GGGGGACGAAAATAAAAGGAATTTGTAAAAGCAAACAATGGTGGGTGTTTTTGTTCGTTGTCTGCGAGAGTCTCTCTCTC TCTGTGTGTGCGTGTGTGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797328: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973283331743AI057877TENU1968T. cruzi epimastigote normalized cDNA Library


Date: 13:39:40 on Thu 23 Nov 117.