EST 1797330 is a singleton


Sequence

>1797330 (1 EST) Length=303 CGGCTATGCGTGTTTGCCCATTGCTGGTGCGCGAGGATGCCGCTGGACTTCTTTTTTTCTGAAGAGAAGTAGGGGGTGTG AGTTCTTTGTCCACCCACTACCAATAAATAATAATAATAGATAATAATAATACTGCAATTGCCCTCTGCACAGGGAAGTC CGGTGGTTGTGGGGCGCGAAAGGATGCCAATTCGTGGTATTGCGGCATTCCCGGTTATCGCAGCAGGTGTGTTTTGCACC TATTTCTCGATGTGCGTATTGAGTGTTGTCTGAATCCCCTCCGAGTTGTGGGGGATGTCGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797330: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973303331745AI057879TENU1970T. cruzi epimastigote normalized cDNA Library


Date: 19:23:44 on Wed 22 Nov 117.