EST 1797335 is a singleton


Sequence

>1797335 (1 EST) Length=242 AGCCGTGCAAGTACATCATGGCAATAAGGCTCCACCGCCCGCCTTCTTCTTCATGAAAAAACAGCGAACAGGGGGAGGTG ATTGGTGGAGTTGACGTCCTTGTCTCATTTTTTTGCCTTTAAAAGCGGCTGTTTCTGGTGGAGGAAATTCAAACTTGTTT TCGTCTCTTTAGTGGCGCATTTGAGTTTTGTCGCGAAGACGCATACGAAAAGTGACGGGGGTTTTGTTTTGGCCGCAGTA TG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797335: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973353331750AI057884TENU1976T. cruzi epimastigote normalized cDNA Library


Date: 0:34:26 on Sat 25 Nov 117.