EST 1797336 is a singleton


Sequence

>1797336 (1 EST) Length=166 GTTGCTGCCTCCAGCGGGAACATATGCGCCTTTCCACGCCCCCTCTGAAATAATAATTGTCTTTTTTGTGTGGATGCACC GCTCATTTTATATATTTTTATGTTTGTTTTGAAAACCCCCTTTTTTTCCATGTAAGTCTTTACGAAGGGTGTGCTTTCCC TCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797336: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973363331751AI057885TENU1977T. cruzi epimastigote normalized cDNA Library


Date: 6:54:13 on Sat 25 Nov 117.