EST 1797346 is a singleton


Sequence

>1797346 (1 EST) Length=331 CGGCTTTGGGGGGCCACGACGCGCGCTTGAAGCGAGGACGTGAGGGTGAGACGAATTTTATTGAGGGCGAGAGGGACGAG GATGGCGAGCTTGTTGTTCTTGGCGAGGCGCACCTGTCGGAGTTGGCGCATGATAAAAACATCCGCAAAAAACTGCTCAG CAGCGAGCTGCAGCAGCTTCTGCGGGTTATTGACGCAAGCCGATCTCGGATTGACGCGCTAGAGGCAGCCATGGCGAATA CACCGGAGTTTAAGGAGTTCTGCGACGAAGTTTTGGGCGTTGTGAGCGCCGCAGAGAGAGGCCTGAGACCGGGTATGAAG TTGAGCTGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797346: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973463331761AI057895TENU1987T. cruzi epimastigote normalized cDNA Library


Date: 7:29:16 on Sat 18 Nov 117.