EST 1797349 is a singleton


Sequence

>1797349 (1 EST) Length=454 TGCTGCTGCGCCACCGACTCAGTTGTCCCAGACCGGCGAGGGCGGGGGTGCAGCGGGAGGCGCCGAGGAGGACACCGCCA CCAACACCACCGACACTGCGTCCAGCGAAGGAAATTCTACGGCGGCAAGCATGCCGGCTCCTCTTTCCTCTGCACCCACA AAGAACGCGCTGGAGAACAGTGTGGGAACTGACGCCTGCTTCCATGACACCCGTCTGCATACCCTGCCACTGCTTGTTCT GGCTGCACTGACGTACGGGACACTGGGCTGAAGAAGTGAATGCGGGCTATTAAAGCCAGCACTTAACCACGGGATGTTTT GCGCTTCTTTTGTTTTATTGCGTAATAAATAATAGAAAGTAATGAATGTGTGTTCTGCTTCATTTGCTTCAGCTGCGCTG CTGTGTGCTCCACGTTTTTGACCCCTGTATCCGTCACTTGGCACGCATCCCAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1797349: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973493331764AI057898TENU1990T. cruzi epimastigote normalized cDNA Library


Date: 14:14:8 on Fri 17 Nov 117.