EST 1797353 is a singleton


Sequence

>1797353 (1 EST) Length=341 GCTCCTGGGAGAAATGGAGATCTGTGAGCGTCGTCAATGATGTGGGGACTCCTGGTCAATGCACGCACCTCCTCCGTGGG CCAGTTGTTCTTGAGAACACGACAAGAGGGGAGGAATGTTTGTGTCTGTGACGATGTTTTTGGCAAAAATCCTATTGCTA TTCTCTCTCTTTCTCTCTTTGTGTGTGTGTGCGTGTGTATTCGGTGTCTCTTTACGTCTCTTCTTTTATTTCCACCCGCC CCTTTGTGCTCCTTCCGAGACTGATGGTGGGCAGGCGGCTTTTGAGATGTTTCTAACAGTTTTGTACTGAAGAGGCCTTT TCTTTTTTTGTGTGTGTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797353: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973533331768AI057902TENU1994T. cruzi epimastigote normalized cDNA Library


Date: 0:8:21 on Sun 19 Nov 117.