EST 1797374 is a singleton


Sequence

>1797374 (1 EST) Length=245 TATGTATATATATATATATGTATATATGAGTGTGTGCATGTGTGTAAACTGCTGGTGCTCGTAGAGTGTTTCCAATGGTA TTGTCATTATTCTTTTTACCAGTGGTGATGGTGGTGATATTAGCGCTGTAGAGGCGTTCCCTCCCCTCCCCTTCCCCCCT ACTTGTTTTTATTTTTTTTAACTTTTTGGTGTCTTTTGCGGTGAGGAGGGGAAGGGGGGTGAGAGAAGTTCACTTGTGTG TCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1797374: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973743331789AI057923TENU2015T. cruzi epimastigote normalized cDNA Library


Date: 2:24:17 on Wed 22 Nov 117.