EST 1797379 is a singleton


Sequence

>1797379 (1 EST) Length=210 TAGAGGACTGCAAGAGATTAATTTATGAGGATGGCCCTGCGTATCTTTGCGGACGTAGAGACTGCGTCGAAGTGTGCGGT CTTGTTTCCAAAGAATGTATCCGCCTGTCAAGTGGTAGCGGAGGAGGCAAAGCTCAGAGCGATGGAGAAATTGAATGCAA TCTACTCCTTTGAAGGAAATCGTACATTCGACAACACTGCTGTGGCTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797379: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973793331794AI057928TENU2020T. cruzi epimastigote normalized cDNA Library


Date: 19:28:50 on Sun 19 Nov 117.