EST 1797387 is a singleton


Sequence

>1797387 (1 EST) Length=442 ACCGGGCTGTTTTACATTCTTTGATGCAGATGATGTCCTGCATGGGGGAATTGTCTAATCTTGCATACAACAATGAAACG TCACTATCGCCCTTTGAGCAGGGTGAGGTCCGTGCGGTTGTGGGAAAGATGGCGGTCTGTTTGGCCACATTTGGCGAGGC ATTTGACATCAATGTGGGCCAAGCCGCCATGGATACTCTTGCGGATCAGTTCCATCGAGCAAGCAACAGTACGTTGGGGC GATCCAGAGCGGAACGGAAGAAGTCTTTCTTGTCGACGCTCGTTGCAGAGGATACTGCAAAAGAGGAAGGAAAGAGCCAT GCTCATGCTCGGCCCAATATTCTTTTGTCACCAACGTCGAATCGAGACTTCTTTGGGTTTCTGGACGAACTCGTTACTTA CAGTCGAAGTGACTTTGAAAAGGCCGAGCTGAAGTGGGTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797387: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973873331802AI057936TENU2028T. cruzi epimastigote normalized cDNA Library


Date: 16:11:13 on Fri 17 Nov 117.