EST 1797388 is a singleton


Sequence

>1797388 (1 EST) Length=421 CTTGTTTGGTTTCCATAGGTTTTCAGGATCCGGCCAGCTGCTCGGACGATTATTCCTTCTTTAACATATCACTTCTGAAG ACAAAGAAATTGTGTTTTTGGTTTTGTTTTGTTTTGTCTTGTTTTTCCTTCTCCCTCGTGTCCCGTCCATCCAACCCCTG CAACGAATAATGCCGCTCTCCTCCCACACGCGGAGAACCACACACAGTGTGTGTCTGTGTGTCTCGGGGAGGTCAGGTGA AACACATCCCCTTCCCCCAGTCCGCCGGGGAGGACGGGGTGTGGGGGTATCCAACACCTCTTCCTTCCTTCGTGCATGAG CAGGAATTAGGGCGTGTCTGGAGGGCGTCGCGTCGTGCGTTCCCTGTATTTGTACTTTTGTGGTAGAAAATATTTTTCTG AACAATGCGCCTCGATGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1797388: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973883331803AI057937TENU2029T. cruzi epimastigote normalized cDNA Library


Date: 2:24:11 on Mon 20 Nov 117.