EST 1797395 is a singleton


Sequence

>1797395 (1 EST) Length=464 ATGCCCGTCACACAGCTGGGACTACGGCAGGAGATCAGCGATGCGCCGCGCGAAACGACAACATGCAGAGGGACTGTGCT GGCAAATCCCCGTGTGTACGGTACAGAACACCGCGACGTCGTGTAAAAGGGTGCCGGTCCGCGCTTCACCGTGATGACGG TCACGACACGATCCGTCTTCTCCTCCACCGTCTGCTGCTCTCGCTTTTGCGGGTTGGCCTTCTTCCACCAGTCTTTCGGC ATCGTCGTTGGGCGATCCCCCGACACGGCACGCATCTCAGTGACTGTGACGTTGCCCTTCACCATCGCCGGGCAGAAGCC TGAAAGACGTAACTCTTTCAGAGCATCCCTCGCGTGGCCAATCACCTCCCCATCATCGGTGACACCAACAAGAAGAACAC CACCCATCGTGGATGCCATGGCAGCAACGGTATGCCGAATACGCTCAAGGTTCACAGTGGAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1797395: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973953331810AI057944TENU2036T. cruzi epimastigote normalized cDNA Library


Date: 15:8:46 on Fri 24 Nov 117.