EST 1804645 is a singleton


Sequence

>1804645 (1 EST) Length=335 TCCAGTACATCAAGAACAAGATGGAATAACCCCATGAGATTTTCCATCATCACTCAAATAACAAGTAGACAACCATAACT ACATGTGAAAATAATTTTCAAATATGCATCTTGGGTAAGCGTACACCAATGAGACGCTCGGAAAAAAAAATCTACATCAA TGGAAAAAATTTAAAAAGTGCTCAAGCCAAAAAATACACAAAAAAGATTAAACTGAAACAAAACAGTAAGATTCAAGCAA GCGGTAAAAATTTCCCAGTAAAGAGAAAGGAAGTATGTGGAAATTCAAAAGTACAGCAGTCTCAGAGAACTTGGCCATGA TGGATTCAACGATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1804645: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046453340597AI065190TENU2070T. cruzi epimastigote normalized cDNA Library


Date: 4:20:13 on Wed 22 Nov 117.