EST 1804660 is a singleton


Sequence

>1804660 (1 EST) Length=398 TCTAAAGAGTCCTTTACGTCTTTCCATTGATTTTTAATTTAATTTTTCTTAAAAACCCTTCTTTTCTTTCCCAGTGTTGC GGGTGTGTGCCGCCCTCCCCGCCCTTTTTTCCCCGCGTCTTCCACCTTACTGAATTCCTGCACACGGAAACACGCACACA CGCACAAACATGCAAATACGCGTACACATGTATGCATACTTGCACGCTCTTTCCAGCTCCTCGTTTTTTCCCCCTTTATG CATGGTGCCCTGCTCTTAGGGTGCTCTGATTAGAAACAACAACAACAACAATTACAGTCATAATGAATTTGATTATGATA ATGATGATAATAATAACAGTGCCCGCGCCCCGTTTCCCAACACTGGCCCCACACTACGTGTTCGTGTGTGTCTGGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804660: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046603340612AI065205TENU2086T. cruzi epimastigote normalized cDNA Library


Date: 20:56:31 on Thu 23 Nov 117.