EST 1804661 is a singleton


Sequence

>1804661 (1 EST) Length=145 TAAGAAGTAGTATTCTCAAGACAACAATTGTCCCCATACACCAATGTCTGGTCGGGACCATCGCAACGCATGGAGCAGGG CAGCCTGGCAAAGTGTCCTTTCACAAGCAGGTTTTATTGGCTTTCCTTTTTTCCCTCCGGTTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046613340613AI065206TENU2087T. cruzi epimastigote normalized cDNA Library


Date: 19:20:9 on Wed 22 Nov 117.