EST 1804662 is a singleton


Sequence

>1804662 (1 EST) Length=322 CGACGGCGACGATGACACGAGGAAGCCTTGCCTCCACAGAGAGAAAGAGAAAGAGAGGATCAAACAAATACTAGAGAAAA AAGGCAAAAAAAAAAAAATGAAAAGTAACTGAGAACCAACCAGAAAGTGAAATACGTGGAGAAAAGAAATTTTGGCGAAC ACATGCGATAATGGGGCGAGAAGAACACCCACCCACTCCTAAATATTTATATTCATCCAGGCGGGAGGAAACAAGCGAGG GGACACAGAGAAGGCCAGAGGAAAAAGAAAAAGGGAAGAACACAGAAGGGCAGACAGACAGGCAGACAGAGGGAGAAGAT AA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1804662: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046623340614AI065207TENU2088T. cruzi epimastigote normalized cDNA Library


Date: 9:57:26 on Wed 22 Nov 117.